ID 21-T337
Registered: 2007.06.28 Last update: 2018.06.11
| Gene Name | carbohydrate sulfotransferase 12 | Gene Symbol | Chst12 | |||
| Chromosome | 5 | Genomic Location | chr5:140,980,000-141,002,000 |  |
||
| Synonyms | C4ST-2, C4S-2, C4ST2, AI595374 | |||||
| Links |
UCSC Genome Browser(chr5:140,980,000-141,002,000) NCBI Gene(59031) IGTC(Chst12,20637) UNIGene(Mm.28934) |
MGI(1929064) KEGG GENES(mmu:59031) EST Profile(mm.28934) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-W8 |
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB330746 | GSS Location | chr5:140,981,578-140,981,650 | Size | 73 |
| Sequence | AGGAGGCGATTTCGGCTGCAGAATCAGCATCACCAGCAACAGCAGCAGCGGCGGTGACTGTGGCG GGCGCTAG |
||||
| Links |
UCSC Browser(chr5:140,981,578-140,981,650) IGTC(Ayu21-T337) |
||||
Homology Search Results
| [AK142155] Mus musculus 13 days embryo heart cDNA, RIKEN full-length enriched library, clone:D330002O18 product:carbohydrate sulfotransferase 12, full insert sequence. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Chst12) |
||||