ID 21-T340
Registered: 2007.06.28 Last update: 2018.06.11
| Gene Name | TELO2 interacting protein 1 | Gene Symbol | Tti1 | |||
| Chromosome | 2 | Genomic Location | chr2:157,805,000-157,870,000 |  |
||
| Synonyms | 2610036D13Rik, AI449463 | |||||
| Links |
UCSC Genome Browser(chr2:157,805,000-157,870,000) NCBI Gene(75425) IGTC(Tti1,4615) UNIGene(Mm.29068) |
MGI(1922675) KEGG GENES(mmu:75425) EST Profile(mm.29068) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB330747 | GSS Location | chr2:157,854,110-157,854,148 | Size | 39 |
| Sequence | GCAGGAGGCGGGAGAGTGAGGGAAAGACTGGAAGACGAG | ||||
| Links |
UCSC Browser(chr2:157,854,110-157,854,148) IGTC(Ayu21-T340) |
||||
Homology Search Results
| [AK128940] Mus musculus cDNA fis, clone TRACH3005702. |
Mouse Information
| Card ID | 1806 | ||||
| Strain Name | B6;CB-Tti1Gt(pU-21T)340Card | ||||
| Internal Code | Ayu21-T340 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Tti1) |
||||