Gene Name | zinc finger protein 407 | Gene Symbol | Zfp407 | |||
Chromosome | 18 | Genomic Location | chr18:84,727,000-84,762,000 | ![]() |
||
Synonyms | 6430585N13Rik, LOC240469, LOC381139, Gm333, Gm334, Gm948, ZNF407 | |||||
Links |
UCSC Genome Browser(chr18:84,727,000-84,762,000) NCBI Gene(240476) IGTC(Zfp407,4171) UNIGene(Mm.329575) |
MGI(2685179) KEGG GENES(mmu:240476) EST Profile(mm.329575) |
Other Clone Trapped This Gene |
---|
Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB354931 | GSS Location | chr18:84,758,830-84,758,898 | Size | 69 |
Sequence | CAGAGGGAAGACGGTGAGCCGGAGGAGTCAGTCAGAGGGCCGAGCAGGAGCGATTTCCCCGACAA ACAG |
||||
Links |
UCSC Browser(chr18:84,758,830-84,758,898) IGTC(Ayu21-T345) |
[AK032536] Mus musculus adult male olfactory brain cDNA, RIKEN full-length enriched library, clone:6430585N13 product:weakly similar to CDNA FLJ31726 FIS, CLONE NT2RI2006735, WEAKLY SIMILAR TO NEOFELIS NEBULOSA STRAIN NNEX ZINC FINGER PROTEIN ZFX GENE (FRAGMENT) [Homo sapiens], full insert sequence. |
Card ID | |||||
Strain Name | |||||
Internal Code | |||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
Links |
IMSR (for Zfp407) |