Gene Name | homeobox containing 1 | Gene Symbol | Hmbox1 | |||
Chromosome | 14 | Genomic Location | chr14:65,430,000-65,570,000 | ![]() |
||
Synonyms | F830020C16Rik , Hot1, AI451877, AI604847 | |||||
Links |
UCSC Genome Browser(chr14:65,430,000-65,570,000) NCBI Gene(219150) IGTC(Hmbox1,23517) UNIGene(Mm.344074) |
MGI(2445066) KEGG GENES(mmu:219150) EST Profile(mm.344074) |
Other Clone Trapped This Gene |
---|
Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB330749 | GSS Location | chr14:65,568,414-65,568,494 | Size | 81 |
Sequence | TCCTCCCTCCCTCAGCCTTGCACTGGGACGCTGGGGAGGGGGCTGAGCAGGGTGCAGAGAACTCT CAGCTGGATTTCCAAG |
||||
Links |
UCSC Browser(chr14:65,568,414-65,568,494) IGTC(Ayu21-T346) |
[AK161592] Mus musculus adult male pituitary gland cDNA, RIKEN full-length enriched library, clone:5330438L16 product:similar to Hypothetical homeobox domain containing protein [Mus musculus], full insert sequence. |
[BC051457] Mus musculus homeobox containing 1, mRNA (cDNA clone MGC:56991 IMAGE:6398463), complete cds. |
Card ID | 1591 | ||||
Strain Name | B6;CB-Hmbox1Gt(pU-21T)346Card | ||||
Internal Code | Ayu21-T346 | ||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. [Paper] "HOT1 is a mammalian direct telomere repeat-binding protein contributing to telomerase recruitment." Kappei, D., Butter, F., Benda, C., Scheibe, M., Drakovic, I., Stevense, M., Novo, C. L., Basquin, C., Araki, M., Araki, K., Krastev, D. B., Kittler, R., Jessberger, R., Londono-Vallejo, J. A., Mann, M., Buchholz, F., EMBO J., 32 (12), 1681-1701 (2013). PubMed ID:23685356. |
||||
Links |
IMSR (for Hmbox1) |