Gene Name | RIKEN cDNA 1110002J07 gene | Gene Symbol | 1110002J07Rik | |||
Chromosome | 10 | Genomic Location | chr10:66,374,743-66,383,278 | ![]() |
||
Synonyms | ||||||
Links |
UCSC Genome Browser(chr10:66,374,743-66,383,278) NCBI Gene(68488) IGTC(1110002J07Rik,) UNIGene(Mm.338835) |
MGI(1915738) KEGG GENES(mmu:) EST Profile(mm.338835) |
Other Clone Trapped This Gene |
---|
Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB330751 | GSS Location | chr10:66,378,604-66,380,540 | Size | 221 |
Sequence | TGGGAGTGGCCTTTGAAGATGAGGATGTCGCTGCAAGCTCCTTCTCTAGCCCCATGTCTGCCTGC CAGCTGCCTGCCTGCTCCCACCACGATGATGATGGACTGAACCCCTGAAACTATTCTTCAGCCAG GAAAAAATAGCAGCGAAGGAGAGAGAGAGAAATCCTTCCCTGGTGAGCTGGATTCCTTGAAGTTG CAGACTATGAAAAGCGGGATGCAGTT |
||||
Links |
UCSC Browser(chr10:66,378,604-66,380,540) IGTC(Ayu21-T348) |
[AK003304] Mus musculus 18-day embryo whole body cDNA, RIKEN full-length enriched library, clone:1110002J07 product:unclassifiable, full insert sequence. |
Card ID | 1783 | ||||
Strain Name | B6;CB-<i>1110002J07Rik<sup>Gt(pU-21T)348Card</sup></i> | ||||
Internal Code | Ayu21-T348 | ||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
Links |
IMSR (for 1110002J07Rik) |