ID 21-T35
Registered: 2006.09.07 Last update: 2018.06.11
| Gene Name | phosphatidylinositol transfer protein, cytoplasmic 1 | Gene Symbol | Pitpnc1 | |||
| Chromosome | 11 | Genomic Location | chr11:107,060,000-107,340,000 |  |
||
| Synonyms | 1110020B03Rik, 5830436L09Rik, C330017I21Rik, RDGBB1, RDGB-BETA, RDGBB, Dnr411, AI662802, AI851387, mrdgBbeta, rdgB-beta | |||||
| Links |
UCSC Genome Browser(chr11:107,060,000-107,340,000) NCBI Gene(71795) IGTC(Pitpnc1,845) UNIGene(Mm.397413) |
MGI(1919045) KEGG GENES(mmu:71795) EST Profile(mm.397413) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-KBT35, 21-W311, 21-KBW149, 21-KBW226 |
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB273134 | GSS Location | chr11:107,328,884-107,328,974 | Size | 91 |
| Sequence | TCTAGAATGACTTTTCTTAATCGGCCAAGGAAGCCAGGCTCTACCTATAGGATAATTATAAATCC TGCACGTGAAACCTGTTTAGACTAAA |
||||
| Links |
UCSC Browser(chr11:107,328,884-107,328,974) IGTC(Ayu21-T35) |
||||
Homology Search Results
| [AL645687] Mouse DNA sequence from clone RP23-478H15 on chromosome 11, complete sequence. |
Mouse Information
| Card ID | 831 | ||||
| Strain Name | B6;CB-Pitpnc1Gt(pU-21T)35Card | ||||
| Internal Code | Ayu21-T35 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Pitpnc1) |
||||