ID 21-T350
Registered: 2007.06.29 Last update: 2018.06.11
| Gene Name | dishevelled associated activator of morphogenesis 1 | Gene Symbol | Daam1 | |||
| Chromosome | 12 | Genomic Location | chr12:72,930,000-73,100,000 |  |
||
| Synonyms | 1700066F09Rik, 2310028E21Rik | |||||
| Links |
UCSC Genome Browser(chr12:72,930,000-73,100,000) NCBI Gene(208846) IGTC(Daam1,8053) UNIGene(Mm.87417) |
MGI(1914596) KEGG GENES(mmu:208846) EST Profile(mm.87417) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB330880 | GSS Location | chr12:72,932,057-72,932,183 | Size | 127 |
| Sequence | ATAGGAGACGAGGGTGATGTCACCTGCGAGTTGGTAACCTACGAGCGGCTGTGAAGGGAACTGTT TAACCGGATCCCATTGTACCGGGAGCGCAGAGCGGCCTTTCCAGCATGCAGCGGCTGCTCAG |
||||
| Links |
UCSC Browser(chr12:72,932,057-72,932,183) IGTC(Ayu21-T350) |
||||
Homology Search Results
| [BC076585] Mus musculus dishevelled associated activator of morphogenesis 1, mRNA (cDNA clone MGC:96307 IMAGE:30622306), complete cds. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Daam1) |
||||