ID 21-T351
Registered: 2007.08.10 Last update: 2021.04.30
| Gene Name | RIKEN cDNA 4930539J05 gene | Gene Symbol | 4930539J05Rik | |||
| Chromosome | 3 | Genomic Location | chr3:135,098,233-135,101,731 |  |
||
| Synonyms | 8030475D13Rik | |||||
| Links |
UCSC Genome Browser(chr3:135,098,233-135,101,731) NCBI Gene(319587) IGTC(4930539J05Rik,) UNIGene(Mm.) |
MGI(1922477) KEGG GENES(mmu:) EST Profile(mm.) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB354925 | GSS Location | chr3:135,098,350-135,098,450 | Size | 123 |
| Sequence | CGGAAGGAGACCTTAGGAGGAAGAGAACCAGGTTCAGTACCCAGCATCTTCATGGTGGTTCACAA CTCATCAGTACCTCCAGTTCCAGTGGATCTGATGCCTTCTGGCCTCCGTGGGCAACAG |
||||
| Links |
UCSC Browser(chr3:135,098,350-135,098,450) IGTC(Ayu21-T351) |
||||
Homology Search Results
| [BB852395] LOCUS BB852395, dbEST Id: 10369153, EST name: BB852395, GenBank Acc: BB852395, GenBank gi: 17093849, CLONE INFO, Clone Id: G370007E23 (5') |
Mouse Information
| Card ID | 1157 | ||||
| Strain Name | B6;CB-Gt(pU-21T)351Imeg | ||||
| Internal Code | Ayu21-T351 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for 4930539J05Rik) |
||||