ID 21-T353
Registered: 2007.06.28 Last update: 2018.06.11
| Gene Name | ubiquitin specific peptidase 32 | Gene Symbol | Usp32 | |||
| Chromosome | 11 | Genomic Location | chr11:84,795,000-84,960,000 |  |
||
| Synonyms | 2900074J03Rik, 6430526O11Rik, AW045245 | |||||
| Links |
UCSC Genome Browser(chr11:84,795,000-84,960,000) NCBI Gene(237898) IGTC(Usp32,6134) UNIGene(Mm.178524) |
MGI(2144475) KEGG GENES(mmu:237898) EST Profile(mm.178524) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB330752 | GSS Location | chr11:84,953,213-84,953,314 | Size | 102 |
| Sequence | GGCGAAAGCAGGCTCCGACCCCCGGCCGAGGGGATGAGGGGAGCATGGGCGCCAAGGAGTCACGG ATCGGATTCCTCAGCTACGAGGAGGCGCTGAGGAGAG |
||||
| Links |
UCSC Browser(chr11:84,953,213-84,953,314) IGTC(Ayu21-T353) |
||||
Homology Search Results
| [AK148221] Mus musculus B16 F10Y cells cDNA, RIKEN full-length enriched library, clone:G370057G19 product:Ubiquitin carboxyl-terminal hydrolase 32 (EC 3.1.2.15) (Ubiquitin thiolesterase 32) (Ubiquitin-specific processing protease 32) (Deubiquitinating enzyme 32) (NY-REN-60 antigen) homolog [Homo sapiens], full insert sequence. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Usp32) |
||||