| Gene Name | protein kinase inhibitor, gamma | Gene Symbol | Pkig | |||
| Chromosome | 2 | Genomic Location | chr2:163,482,000-163,556,000 | |||
| Synonyms | PKIgamma | |||||
| Links |
UCSC Genome Browser(chr2:163,482,000-163,556,000) NCBI Gene(18769) IGTC(Pkig,29880) UNIGene(Mm.10091) |
MGI(1343086) KEGG GENES(mmu:18769) EST Profile(mm.10091) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB364965 | GSS Location | chr2:163,484,135-163,484,228 | Size | 95 |
| Sequence | GAGGCAACGGCTCGGCGGCGGGCTGCGGGCGCCAGGCGGCCCCGGGGAGGCGCTCGCGCCGGCGG CCGGGGCTCTACGAGGCGACAAGGCGGCAG |
||||
| Links |
UCSC Browser(chr2:163,484,135-163,484,228) IGTC(Ayu21-T354) |
||||
| [AK164716] Mus musculus 0 day neonate kidney cDNA, RIKEN full-length enriched library, clone:D630032C22 product:protein kinase inhibitor, gamma, full insert sequence. |
| Card ID | 1095 | ||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. [Paper] "Development of an efficient screening system to identify novel bone metabolism-related genes using the exchangeable gene trap mutagenesis mouse models."Syuji Kurogi, Tomohisa Sekimoto, Taro Funamoto, Tomomi Ota, Shihoko Nakamura, Takuya Nagai, Mai Nakahara, Kumiko Yoshinobu, Kimi Araki, Masatake Araki and Etsuo Chosa, Sci. Rep., 7, 40692 (2017). doi: 10.1038/srep40692. PubMed ID:28106071. |
||||
| Links |
IMSR (for Pkig) |
||||
| Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
|---|---|
| Image | Male Female |