Gene Name | proteasome (prosome, macropain) 26S subunit, non-ATPase, 12 | Gene Symbol | Psmd12 | |||
Chromosome | 11 | Genomic Location | chr11:107,340,000-107,360,000 | ![]() |
||
Synonyms | 1500002F15Rik, P55, AI480719 | |||||
Links |
UCSC Genome Browser(chr11:107,340,000-107,360,000) NCBI Gene(66997) IGTC(Psmd12,7910) UNIGene(Mm.21667) |
MGI(1914247) KEGG GENES(mmu:66997) EST Profile(mm.21667) |
Other Clone Trapped This Gene |
---|
21-KBW146 |
Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB330753 | GSS Location | chr11:107,340,818-107,340,998 | Size | 181 |
Sequence | CGGGCGACTTCCGGTGCGAGTGACGAGTGGTGGCCGAACCTGGGGTACAGCAGGGGACTCTTAGG CAGGGACCATGGCGGACGGTGGCTCGGAGCGGGCCGATGGGCGCATTGTGAAGATGGAAGTGGAC TACAGCGCCACGGTGGACCAGCGCCTGCCTGAGTGCGAGAAGCTGGCCAAG |
||||
Links |
UCSC Browser(chr11:107,340,818-107,340,998) IGTC(Ayu21-T355) |
[AK007619] Mus musculus 10 day old male pancreas cDNA, RIKEN full-length enriched library, clone:1810027K11 product:proteasome (prosome, macropain) 26S subunit, non-ATPase, 12, full insert sequence. |
Card ID | |||||
Strain Name | |||||
Internal Code | |||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
Links |
IMSR (for Psmd12) |