ID 21-T4
Registered: 2007.03.29 Last update: 2018.06.11
| Gene Name | B1 repeat | Gene Symbol | B1 | |||
| Chromosome | Unlocalized | Genomic Location |  |
|||
| Synonyms | ||||||
| Links |
UCSC Genome Browser() NCBI Gene() IGTC(B1,) UNIGene(Mm.) |
MGI() KEGG GENES(mmu:) EST Profile(mm.) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB299415 | GSS Location | Size | 33 | |
| Sequence | AATCCCAGCACTTGGGAGGAAGAAGCAACACAG | ||||
| Links |
UCSC Browser() IGTC(Ayu21-T4) |
||||
Homology Search Results
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for B1) |
||||