ID 21-T402
Registered: 2007.10.27 Last update: 2018.06.11
| Gene Name | teneurin transmembrane protein 4 | Gene Symbol | Tenm4 | |||
| Chromosome | 7 | Genomic Location | chr7:103,350,000-104,070,000 |  |
||
| Synonyms | Doc4, ELM2, l(7)-3Rn, l7Rn3, mKIAA1302, Odz4, Ten-m4, R75022 | |||||
| Links |
UCSC Genome Browser(chr7:103,350,000-104,070,000) NCBI Gene(23966) IGTC(Tenm4,5861) UNIGene(Mm.254610) |
MGI(2447063) KEGG GENES(mmu:23966) EST Profile(mm.254610) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-W111, 21-W258, 21-W260, 21-W453, 21-W81 |
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB366553 | GSS Location | chr7:103,360,341-103,503,921 | Size | 216 |
| Sequence | AGAGGGTGTCCCTGTGCTGAGCTGTACGGCCGTGCTCGGAGGATGTTCGCTGAACAGTATCATGG GCAATTATATAAGCTGCCTCAGTGATCTCCCAGATCTGTATTGCAAGCACCCGGCTCTTGAAAGA CAACCCTGAAAGTTTTACTGCTTGGGGACTATGGACAGTCTGAGGCTGAGAGAGGGCTAGTGATT TCTCGGACACTTGGGCAGTAG |
||||
| Links |
UCSC Browser(chr7:103,360,341-103,503,921) IGTC(Ayu21-T402) |
||||
Homology Search Results
| [AK147579] Mus musculus cDNA, RIKEN full-length enriched library, clone:M5C1082H18 product:odd Oz/ten-m homolog 4 (Drosophila), full insert sequence. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Tenm4) |
||||