ID 21-T411
Registered: 2007.09.17 Last update: 2018.06.11
| Gene Name | COP1, E3 ubiquitin ligase | Gene Symbol | Cop1 | |||
| Chromosome | 1 | Genomic Location | chr1:161,160,000-161,280,000 |  |
||
| Synonyms | Cop1, Rfwd2, C80879, AI316802 | |||||
| Links |
UCSC Genome Browser(chr1:161,160,000-161,280,000) NCBI Gene(26374) IGTC(Cop1,8757) UNIGene(Mm.328135) |
MGI(1347046) KEGG GENES(mmu:26374) EST Profile(mm.328135) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB361482 | GSS Location | chr1:161,162,337-161,162,403 | Size | 68 |
| Sequence | TGCCCCGGCGACCTCCTCGGCAGTCATGGCTCCTCGGATGTGAATAGTATCCCCCGCCCCCTCGC GTA |
||||
| Links |
UCSC Browser(chr1:161,162,337-161,162,403) IGTC(Ayu21-T411) |
||||
Homology Search Results
| [DX562792] YHC405 BayGenomics Gene Trap Library pGT0Lxf Mus musculus cDNA, mRNA sequence, gi|91095956|gb|DX562792.1|[91095956] |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Cop1) |
||||