ID 21-T421
Registered: 2007.09.28 Last update: 2018.06.11
| Gene Name | DnaJ heat shock protein family (Hsp40) member C7 | Gene Symbol | Dnajc7 | |||
| Chromosome | 11 | Genomic Location | chr11:100,444,000-100,482,000 |  |
||
| Synonyms | 2010003F24Rik, 2010004G07Rik, mDj11, mTpr2, Ttc2, CCRP | |||||
| Links |
UCSC Genome Browser(chr11:100,444,000-100,482,000) NCBI Gene(56354) IGTC(Dnajc7,3518) UNIGene(Mm.402409) |
MGI(1928373) KEGG GENES(mmu:56354) EST Profile(mm.402409) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB362538 | GSS Location | chr11:100,480,842-100,480,937 | Size | 97 |
| Sequence | CTCTGGTGCCCGGCGGTAAGATGGCGGCTACCGCGGAGTGCGATGTGGTAATGGCGGCGACCGAG CCTGAACTGCTGGAGGACGAAGACGCCAAGAG |
||||
| Links |
UCSC Browser(chr11:100,480,842-100,480,937) IGTC(Ayu21-T421) |
||||
Homology Search Results
| [BC055729] Mus musculus DnaJ (Hsp40) homolog, subfamily C, member 7, mRNA (cDNA clone MGC:66940 IMAGE:6414499), complete cds. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Dnajc7) |
||||