Gene Name | growth factor receptor bound protein 2 | Gene Symbol | Grb2 | |||
Chromosome | 11 | Genomic Location | chr11:115,505,000-115,570,000 | ![]() |
||
Synonyms | Ash, AA408164 | |||||
Links |
UCSC Genome Browser(chr11:115,505,000-115,570,000) NCBI Gene(14784) IGTC(Grb2,9676) UNIGene(Mm.439649) |
MGI(95805) KEGG GENES(mmu:14784) EST Profile(mm.439649) |
Other Clone Trapped This Gene |
---|
Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB362540 | GSS Location | chr11:115,560,466-115,560,563 | Size | 100 |
Sequence | TAGCACTGAGCGGCGCTCAGAATGGAAGCCATCGCCAAATATGACTTCCAAAGCTACTGCTGCAC GATGAGCTGAGTTCAAAAGGGGGGACATCCTTAAG |
||||
Links |
UCSC Browser(chr11:115,560,466-115,560,563) IGTC(Ayu21-T434) |
[MMU07617] Mus musculus Grb2 adaptor protein (grb2) mRNA, complete cds. |
Card ID | |||||
Strain Name | |||||
Internal Code | |||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
Links |
IMSR (for Grb2) |