Gene Name | calmodulin 2 | Gene Symbol | Calm2 | |||
Chromosome | 17 | Genomic Location | chr17:87,832,500-87,846,500 | ![]() |
||
Synonyms | 1500001E21Rik, Cam2, CamC, AL024017 | |||||
Links |
UCSC Genome Browser(chr17:87,832,500-87,846,500) NCBI Gene(12314) IGTC(Calm2,1002) UNIGene(Mm.329243) |
MGI(103250) KEGG GENES(mmu:12314) EST Profile(mm.329243) |
Other Clone Trapped This Gene |
---|
Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB266492 | GSS Location | chr17:87,842,036-87,846,203 | Size | 102 |
Sequence | AGTCCGAGTGGAGCGAGCGAGTCGAGCGGTTGTCTGGTCGCGTCTCGGAAACCCGTAGCCCTTGC AGCATGGCTGACCAACTGANTGAAGAGCAGATTGCAG |
||||
Links |
UCSC Browser(chr17:87,842,036-87,846,203) IGTC(Ayu21-T44) |
[AK161984] Mus musculus 12 days embryo female ovary cDNA, RIKEN full-length enriched library, clone:6620403E19 product:calmodulin 2, full insert sequence. |
Card ID | 1061 | ||||
Strain Name | B6;CB-Calm2Gt(pU-21T)44Card | ||||
Internal Code | Ayu21-T44 | ||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
Links |
IMSR (for Calm2) |