ID 21-T440
Registered: 2007.09.28 Last update: 2018.06.12
| Gene Name | pyruvate dehyrogenase phosphatase catalytic subunit 2 | Gene Symbol | Pdp2 | |||
| Chromosome | 8 | Genomic Location | chr8:107,115,300-107,120,900 |  |
||
| Synonyms | Gm1705, mKIAA1348, 4833426J09Rik | |||||
| Links |
UCSC Genome Browser(chr8:107,115,300-107,120,900) NCBI Gene(382051) IGTC(Pdp2,25512) UNIGene(Mm.290750) |
MGI(1918878) KEGG GENES(mmu:382051) EST Profile(mm.290750) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB362541 | GSS Location | chr8:107,115,371-107,115,495 | Size | 125 |
| Sequence | GGCCTCTCCAGGGAAGTAAAACCCAGTCGCAGCAACCGCGGAACTGTGCTCAGGACCAGAGTGAG CCGAGAGGATCCGCCGAGTGCCAGCGGCGCCAGCTGGGGAGGAGAGGACGAGGATACGAG |
||||
| Links |
UCSC Browser(chr8:107,115,371-107,115,495) IGTC(Ayu21-T440) |
||||
Homology Search Results
| [BY019019] BY019019 RIKEN full-length enriched, mammary gland RCB-0526 Jyg-MC(A) cDNA Mus musculus cDNA clone G830033F03 5-, mRNA sequence, gi|26079268|dbj|BY019019.1|[26079268] |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Pdp2) |
||||