ID 21-T441
Registered: 2007.11.02 Last update: 2018.06.12
| Gene Name | protein phosphatase 1A, magnesium dependent, alpha isoform | Gene Symbol | Ppm1a | |||
| Chromosome | 12 | Genomic Location | chr12:73,835,000-73,897,000 |  |
||
| Synonyms | 2310003C21Rik, 2900017D14Rik, MMPa-2, MPPa-1, Mpp alpha, AI427932, AU017636 | |||||
| Links |
UCSC Genome Browser(chr12:73,835,000-73,897,000) NCBI Gene(19042) IGTC(Ppm1a,15066) UNIGene(Mm.261045) |
MGI(99878) KEGG GENES(mmu:19042) EST Profile(mm.261045) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB366554 | GSS Location | chr12:73,836,832-73,862,618 | Size | 160 |
| Sequence | GGATTTAAGAACATTGTCAGAAGACTCACTGTTCTCTGCACACTTTCCAGCACATTTGTTGGAGC CGACTTCTACAGAAGACCAGCTGAAACAACTAGCCTTGTGGGACTGACCGCCGCCCCGGCCGACC GAGGGACCCGCCCGCCCGCGGCTGCACCGG |
||||
| Links |
UCSC Browser(chr12:73,836,832-73,862,618) IGTC(Ayu21-T441) |
||||
Homology Search Results
| [CJ080914] CJ080914 RIKEN full-length enriched mouse cDNA library, C57BL/6J whole body morula Mus musculus cDNA clone I020055G01 5-, mRNA sequence gi|76181183|dbj|CJ080914.1|[76181183] |
| [D28117] Mus musculus mRNA for magnesium dependent protein phosphatase alpha, complete cds. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Ppm1a) |
||||