Gene Name | 1-acylglycerol-3-phosphate O-acyltransferase 1 (lysophosphatidic acid acyltransferase, alpha) | Gene Symbol | Agpat1 | |||
Chromosome | 17 | Genomic Location | chr17:34,742,500-34,750,700 | |||
Synonyms | 1-AGP, 1-AGPAT, AW047140 | |||||
Links |
UCSC Genome Browser(chr17:34,742,500-34,750,700) NCBI Gene(55979) IGTC(Agpat1,28292) UNIGene(Mm.8684) |
MGI(1932075) KEGG GENES(mmu:55979) EST Profile(mm.8684) |
Other Clone Trapped This Gene |
---|
Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB366555 | GSS Location | chr17:34,742,973-34,743,116 | Size | 144 |
Sequence | TCCATCGGCCGGGGCTAGGACATCCCCAAATCCTGTCGCCCCCTTGGCACCGACACCGAGACAGA GATACAGCCAGCCGCCACCACCGTTGCCGCAGCCTGGCTGGGGAGGGGGCCCGTCCCCCAGGCTC CCCGCCCCATTGAG |
||||
Links |
UCSC Browser(chr17:34,742,973-34,743,116) IGTC(Ayu21-T443) |
Card ID | |||||
Strain Name | |||||
Internal Code | |||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
Links |
IMSR (for Agpat1) |