ID 21-T459
Registered: 2007.11.02 Last update: 2018.06.12
| Gene Name | RAB GTPase activating protein 1-like | Gene Symbol | Rabgap1l | |||
| Chromosome | 1 | Genomic Location | chr1:162,145,000-162,730,000 |  |
||
| Synonyms | 5830411O09Rik, 8430421H08Rik, 9630005B12Rik, Hh1, mKIAA0471, HHL, Hh1, AW049894 | |||||
| Links |
UCSC Genome Browser(chr1:162,145,000-162,730,000) NCBI Gene(29809) IGTC(Rabgap1l,26184) UNIGene(Mm.25833) |
MGI(1352507) KEGG GENES(mmu:29809) EST Profile(mm.25833) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB366556 | GSS Location | chr1:162,722,868-162,722,985 | Size | 118 |
| Sequence | CCCTGGGCTTCGGCCGCGGCGGAGTGAACGGGACGGGCCCGGCCGCAGAGCTCTGGGCGGCGGGT GGGACTCGGGCGTCTGACAGAGTTGTTGTTCCGGCACGGCCGCGGAGACGTGA |
||||
| Links |
UCSC Browser(chr1:162,722,868-162,722,985) IGTC(Ayu21-T459) |
||||
Homology Search Results
| [AK035796] Mus musculus 16 days neonate cerebellum cDNA, RIKEN full-length enriched library, clone:9630005B12 product:weakly similar to RAB6 GTPASE ACTIVATING PROTEIN, GAPCENA [Homo sapiens], full insert sequence. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Rabgap1l) |
||||