ID 21-T469
Registered: 2007.11.30 Last update: 2018.06.12
| Gene Name | Kruppel-like factor 12 | Gene Symbol | Klf12 | |||
| Chromosome | 14 | Genomic Location | chr14:100,200,000-100,700,000 |  |
||
| Synonyms | 2700063E05Rik, AP-2rep, B130052C06Rik, D530033K05Rik, AI225908, AI315654 | |||||
| Links |
UCSC Genome Browser(chr14:100,200,000-100,700,000) NCBI Gene(16597) IGTC(Klf12,2396) UNIGene(Mm.458816) |
MGI(1333796) KEGG GENES(mmu:16597) EST Profile(mm.458816) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-T505, 21-T299 |
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB370166 | GSS Location | chr14:100,683,750-100,683,918 | Size | 170 |
| Sequence | GGAGCTGCGGGCTGCAAAGGGAGGAGAAGCAGCTTCTTGCAACCCCCTCGGCTGGGCCCCGGGGT AATTCGATGCGGGCCTGGCGTGGCTCCCCACGTTAGACCCGGGCTCGCGTCTCGGCAGCCTCCAC CCACCGGCCCACCCTACATTTAGCGCATCATGTGATCCGG |
||||
| Links |
UCSC Browser(chr14:100,683,750-100,683,918) IGTC(Ayu21-T469) |
||||
Homology Search Results
| [CD560333] B0410G05-5 NIA Mouse E6.5 Whole Embryo cDNA Library (Long) Mus musculus cDNA clone NIA:B0410G05 IMAGE:30439660 5-, mRNA sequence gi|31604226|gb|CD560333.1|[31604226] |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Klf12) |
||||