ID 21-T483
Registered: 2008.01.13 Last update: 2018.06.12
| Gene Name | diacylglycerol kinase, delta | Gene Symbol | Dgkd | |||
| Chromosome | 1 | Genomic Location | chr1:89,749,000-89,843,000 |  |
||
| Synonyms | dgkd-2, DGKdelta, AI841987, D330025K09 | |||||
| Links |
UCSC Genome Browser(chr1:89,749,000-89,843,000) NCBI Gene(227333) IGTC(Dgkd,) UNIGene(Mm.277217) |
MGI(2138334) KEGG GENES(mmu:227333) EST Profile(mm.277217) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB375395 | GSS Location | chr1:89,749,931-89,750,031 | Size | 102 |
| Sequence | CGCCGCCTGAGGAGTCGTCCGACAGTGAACCCGAGGCTGAGCCGGGCTCCCCGCAGAAGCTTATC CGTAAGGTGTCCACGTCGGGCCAGATTCCGGCAGAAG |
||||
| Links |
UCSC Browser(chr1:89,749,931-89,750,031) IGTC(Ayu21-T483) |
||||
Homology Search Results
| [DU709053] AZ0331 Sanger Institute Gene Trap Library pGT0lxr Mus musculus cDNA, mRNA sequence, gi|82412346|gb|DU709053.1|[82412346] |
Mouse Information
| Card ID | 1166 | ||||
| Strain Name | B6;CB-DgkdGt(pU-21T)483Imeg | ||||
| Internal Code | Ayu21-T483 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Dgkd) |
||||