| Gene Name | zinc finger protein 91 | Gene Symbol | Zfp91 | |||
| Chromosome | 19 | Genomic Location | chr19:12,837,000-12,871,000 | |||
| Synonyms | 9130014I08Rik, A530054C17Rik, Pzf, Zfp-91, AL024263, AW545902 | |||||
| Links |
UCSC Genome Browser(chr19:12,837,000-12,871,000) NCBI Gene(109910) IGTC(Zfp91,) UNIGene(Mm.290924) |
MGI(104854) KEGG GENES(mmu:109910) EST Profile(mm.290924) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB375396 | GSS Location | chr19:12,864,750-12,869,511 | Size | 67 |
| Sequence | CCGTCTCCTGCTCAGGGCAAGAAGAGTCCGCGACTCCAGTGTATAGAAAAACTAACAACTGATAA AG |
||||
| Links |
UCSC Browser(chr19:12,864,750-12,869,511) IGTC(Ayu21-T484) |
||||
| [AK147560] us musculus cDNA, RIKEN full-length enriched library, clone:M5C1079D24 product:zinc finger protein 91, full insert sequence. |
| Card ID | 1158 | ||||
| Strain Name | B6;CB-Zfp91Gt(pU-21T)484Imeg | ||||
| Internal Code | Ayu21-T484 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Zfp91) |
||||