Gene Name | DEAH (Asp-Glu-Ala-His) box polypeptide 32 | Gene Symbol | Dhx32 | |||
Chromosome | 7 | Genomic Location | chr7:140,910,787-140,976,212 | ![]() |
||
Synonyms | Ddx32, muDDX32, AA408140, 3110079L04Rik, 4732469F02Rik | |||||
Links |
UCSC Genome Browser(chr7:140,910,787-140,976,212) NCBI Gene(101437) IGTC(Dhx32,15999) UNIGene(Mm.199223) |
MGI(2141813) KEGG GENES(mmu:101437) EST Profile(mm.199223) |
Other Clone Trapped This Gene |
---|
Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB375398 | GSS Location | chr7:140,968,285-140,968,373 | Size | 89 |
Sequence | GTCAGCTCCTCTAGGGACCACGCGAACGTCGGCCGGGCTCGGGAAGCTCCCGCCCAGGCTCTGGG AGGCCTCGGCGGCCGCCGCTGCAG |
||||
Links |
UCSC Browser(chr7:140,968,285-140,968,373) IGTC(Ayu21-T487) |
[AK167889] Mus musculus CRL-1722 L5178Y-R cDNA, RIKEN full-length enriched library, clone:I730035G22 product:DEAH (Asp-Glu-Ala-His) box polypeptide 32, full insert sequence. |
Card ID | |||||
Strain Name | |||||
Internal Code | |||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
Links |
IMSR (for Dhx32) |