ID 21-T49
Registered: 2006.09.07 Last update: 2018.06.12
| Gene Name | NIPBL cohesin loading factor | Gene Symbol | Nipbl | |||
| Chromosome | 15 | Genomic Location | chr15:8,234,247-8,420,890 |  |
||
| Synonyms | 4921518A06Rik, 4933421G18Rik, Idn3 | |||||
| Links |
UCSC Genome Browser(chr15:8,234,247-8,420,890) NCBI Gene(71175) IGTC(Nipbl,14470) UNIGene(Mm.240329) |
MGI(1913976) KEGG GENES(mmu:71175) EST Profile(mm.240329) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB273135 | GSS Location | chr15:8,394,125-8,394,177 | Size | 53 |
| Sequence | CTTGCCACCGCGGCCTCGGCCTCCGCTCCGGATTCAGACGCCGATTCGCCCAG | ||||
| Links |
UCSC Browser(chr15:8,394,125-8,394,177) IGTC(Ayu21-T49) |
||||
Homology Search Results
| [AJ627033] Mus musculus mRNA for delangin (Nipbl gene), variant A. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Nipbl) |
||||