Gene Name | enoyl Coenzyme A hydratase domain containing 2 | Gene Symbol | Echdc2 | |||
Chromosome | 4 | Genomic Location | chr4:107,837,000-107,853,000 | ![]() |
||
Synonyms | 1300017C12Rik, 2610009M20Rik, D4Ertd765e | |||||
Links |
UCSC Genome Browser(chr4:107,837,000-107,853,000) NCBI Gene(52430) IGTC(Echdc2,2879) UNIGene(Mm.270783) |
MGI(1289238) KEGG GENES(mmu:52430) EST Profile(mm.270783) |
Other Clone Trapped This Gene |
---|
Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB375399 | GSS Location | chr4:107,838,167-107,842,553 | Size | 188 |
Sequence | CCGTGCTCCTGGAGGTTCTCGGGGGCCCGGGACTGCGCCTCTCACGCGACGACCAGGACACCCGA AATCCAAGTGCAGGCTCTGACAGGTCCCAACCAAGCTGCTGGAAGCTCTGGCCCAGCTTCGGGAA GACCAGCAAGTCCGGGTCCTGCTCTTCAGAAGTGCGGTGAAGGGAGTGTTCTGTGCAG |
||||
Links |
UCSC Browser( chr4:107,838,167-107,842,553) IGTC(Ayu21-T490) |
[AK011365] Mus musculus 10 days embryo whole body cDNA, RIKEN full-length enriched library, clone:2610009M20 product:weakly similar to AU-BINDING PROTEIN/ENOYL-COA HYDRATASE [Homo sapiens], full insert sequence. |
Card ID | 1134 | ||||
Strain Name | B6;CB-Echdc2Gt(pU-21T)490Imeg | ||||
Internal Code | Ayu21-T490 | ||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
Links |
IMSR (for Echdc2) |