Gene Name | succinate dehydrogenase complex, subunit C, integral membrane protein | Gene Symbol | Sdhc | |||
Chromosome | 1 | Genomic Location | chr1:173,058,000-173,082,000 | ![]() |
||
Synonyms | 0610010E03Rik, AI316496, AU019277 | |||||
Links |
UCSC Genome Browser(chr1:173,058,000-173,082,000) NCBI Gene(66052) IGTC(Sdhc,1613) UNIGene(Mm.198138) |
MGI(1913302) KEGG GENES(mmu:66052) EST Profile(mm.198138) |
Other Clone Trapped This Gene |
---|
Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB375780 | GSS Location | chr1:173,073,743-173,080,730 | Size | 147 |
Sequence | CCGTCCAGGCCGGAACTCAAGATGGCTGCGTTCTTGCTGAGACATGTCAGCCGTCACTGCCTCCG AGCCCACCTGAATGCTCAGCTTTGTATCAGAAATGCTGCTCCTTTGGGAACCACAGCTAAGGAGG AGATGGAGCGGTTCTGA |
||||
Links |
UCSC Browser(chr1:173,073,743-173,080,730) IGTC(Ayu21-T504) |
[AK032458] Mus musculus adult male olfactory brain cDNA, RIKEN full-length enriched library, clone:6430550J24 product:similar to integral membrane protein CII-3 (fragment) [Cricetulus griseus], full insert sequence. |
Card ID | |||||
Strain Name | |||||
Internal Code | |||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
Links |
IMSR (for Sdhc) |