ID 21-T509
Registered: 2008.02.20 Last update: 2018.06.13
| Gene Name | outer dense fiber of sperm tails 2 | Gene Symbol | Odf2 | |||
| Chromosome | 2 | Genomic Location | chr2:29,744,000-29,788,000 |  |
||
| Synonyms | MMTEST29, cenexin, AI848335 | |||||
| Links |
UCSC Genome Browser(chr2:29,744,000-29,788,000) NCBI Gene(18286) IGTC(Odf2,3768) UNIGene(Mm.330116) |
MGI(1098824) KEGG GENES(mmu:18286) EST Profile(mm.330116) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB383667 | GSS Location | chr2:29,747,728-29,749,032 | Size | 138 |
| Sequence | GGAGTAACGAGTCTCACACAGAAAAAAGTCTTGAGAACACCTTGTGGCGCACCCAGTGTAACTGT TACGAAATCTCATAAGCGCGGAATGAAAGGGGACACCGTGAATGTACGGCGGAGTGTCCGGGTGA AAACCAAG |
||||
| Links |
UCSC Browser(chr2:29,747,728-29,749,032) IGTC(Ayu21-T509) |
||||
Homology Search Results
| [AF034105] Mus musculus outer dense fiber 2 (Odf2) mRNA, complete cds. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Odf2) |
||||