ID 21-T513
Registered: 2008.10.19 Last update: 2018.06.13
| Gene Name | misshapen-like kinase 1 (zebrafish) | Gene Symbol | Mink1 | |||
| Chromosome | 11 | Genomic Location | chr11:70,376,000-70,430,000 |  |
||
| Synonyms | Map4k6, MINK, Misshapen/NIKs-related kinase, Ysk2, B55 | |||||
| Links |
UCSC Genome Browser(chr11:70,376,000-70,430,000) NCBI Gene(50932) IGTC(Mink1,38035) UNIGene(Mm.42967) |
MGI(1355329) KEGG GENES(mmu:50932) EST Profile(mm.42967) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-W470 |
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB465710 | GSS Location | chr11:70,376,534-70,376,628 | Size | 100 |
| Sequence | CAGGAAGTGAGCGAGCCGGAGCGTGAGTGGCCCCGCGGCGGCCATGGGCGACCCAGCCCCCGCCC GCAGCCTGGACGACATCGACCTGTCTGCCCTGCGG |
||||
| Links |
UCSC Browser(chr11:70,376,534-70,376,628) IGTC(Ayu21-T513) |
||||
Homology Search Results
| [AB041925] Mus musculus mRNA for GCK family kinase MINK2, complete cds. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Mink1) |
||||