ID 21-T514
Registered: 2008.01.15 Last update: 2018.06.13
| Gene Name | integrin beta 7 | Gene Symbol | Itgb7 | |||
| Chromosome | 15 | Genomic Location | chr15:102,046,200-102,063,000 |  |
||
| Synonyms | Ly69 | |||||
| Links |
UCSC Genome Browser(chr15:102,046,200-102,063,000) NCBI Gene(16421) IGTC(Itgb7,20514) UNIGene(Mm.58) |
MGI(96616) KEGG GENES(mmu:16421) EST Profile(mm.58) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB375783 | GSS Location | chr15:102,062,282-102,062,352 | Size | 71 |
| Sequence | TGCCTCTCCATCTGTACACAAGGGCTGCCACTGCCACCGGCGGAGGAAGGGCTGCTCCTCCTCAA GCACCT |
||||
| Links |
UCSC Browser(chr15:102,062,282-102,062,352) IGTC(Ayu21-T514) |
||||
Homology Search Results
| [AK154766] Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN full-length enriched library, clone:F630106B20 product:integrin beta 7, full insert sequence. |
Mouse Information
| Card ID | 1159 | ||||
| Strain Name | B6;CB-Itgb7Gt(pU-21T)514Imeg | ||||
| Internal Code | Ayu21-T514 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Itgb7) |
||||