ID 21-T518
Registered: 2008.01.15 Last update: 2018.06.13
| Gene Name | protein phosphatase 2, regulatory subunit B', gamma | Gene Symbol | Ppp2r5c | |||
| Chromosome | 12 | Genomic Location | chr12:111,720,000-111,825,000 |  |
||
| Synonyms | 2610043M05Rik, 2700063L20Rik, B56/PP2A gamma, Band 8A, D12Bwg0916e, mKIAA0044, C85228, AI060890, AW545884 | |||||
| Links |
UCSC Genome Browser(chr12:111,720,000-111,825,000) NCBI Gene(26931) IGTC(Ppp2r5c,6434) UNIGene(Mm.240396) |
MGI(1349475) KEGG GENES(mmu:26931) EST Profile(mm.240396) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB375785 | GSS Location | chr12:111,760,804-111,760,900 | Size | 97 |
| Sequence | GGAAGTAAAGCGCGCTGCGCTGAGCGAGATGGTGGAGTATATCACCCACAACCGGAACGTGATCA CGGAGCCCATTTACCCCGAGGCCGTCCACATG |
||||
| Links |
UCSC Browser(chr12:111,760,804-111,760,900) IGTC(Ayu21-T518) |
||||
Homology Search Results
| [BC003979] Mus musculus protein phosphatase 2, regulatory subunit B (B56), gamma isoform, mRNA (cDNA clone MGC:7455 IMAGE:3489999), complete cds. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Ppp2r5c) |
||||