| Gene Name | capping protein (actin filament) muscle Z-line, beta | Gene Symbol | Capzb | |||
| Chromosome | 4 | Genomic Location | chr4:138,748,000-138,850,000 | |||
| Synonyms | 1700120C01Rik, Cappb1, CPB1, CPB2, CPbeta1, CPbeta2, CPbeat2, AI325129 | |||||
| Links |
UCSC Genome Browser(chr4:138,748,000-138,850,000) NCBI Gene(12345) IGTC(Capzb,664) UNIGene(Mm.2945) |
MGI(104652) KEGG GENES(mmu:12345) EST Profile(mm.2945) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-T523 |
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB375789 | GSS Location | chr4:138,748,846-138,748,943 | Size | 98 |
| Sequence | ACTCTTGGGCACCCGGGGAAGTGGAAGCGCAGGGCCCTGCTGCGGGGGGGAGAGCCACAGACGCC GGGACAGGGACCGTCGCCGCCGCCGCCACCATG |
||||
| Links |
UCSC Browser(chr4:138,748,846-138,748,943) IGTC(Ayu21-T524) |
||||
| [AK160082] Mus musculus osteoclast-like cell cDNA, RIKEN full-length enriched library, clone:I420048E21 product:capping protein (actin filament) muscle Z-line, beta, full insert sequence. |
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Capzb) |
||||