ID 21-T525
Registered: 2008.01.15 Last update: 2018.06.13
| Gene Name | transportin 1 | Gene Symbol | Tnpo1 | |||
| Chromosome | 13 | Genomic Location | chr13:99,610,000-99,697,000 |  |
||
| Synonyms | MIP; TRN; IPO2; MIP1; Kpnb2; AU021749; D13Ertd688e | |||||
| Links |
UCSC Genome Browser(chr13:99,610,000-99,697,000) NCBI Gene(238799) IGTC(Tnpo1,2258) UNIGene(Mm.173286) |
MGI(2681523) KEGG GENES(mmu:238799) EST Profile(mm.173286) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB375790 | GSS Location | chr13:99,696,206-99,696,298 | Size | 94 |
| Sequence | GTTCCGCAGCCATTTCAGGCCCCGGACGGGAGGCAGCGCCGCTTCGGCAGAAAGGCCCGAGCGCC GGAGGACTTCTGGGATGGTGTGGGACCGG |
||||
| Links |
UCSC Browser(chr13:99,696,206-99,696,298) IGTC(Ayu21-T525) |
||||
Homology Search Results
| [AK030580] Mus musculus adult male pituitary gland cDNA, RIKEN full-length enriched library, clone:5330434M13 product:IMPORTIN BETA-2 SUBUNIT (KARYOPHERIN BETA-2 SUBUNIT) (TRANSPORTIN) (M9 REGION INTERACTION PROTEIN) (MIP) homolog [Homo sapiens], full insert sequence. |
Mouse Information
| Card ID | 2313 | ||||
| Strain Name | B6.Cg-Tnpo1Gt(pU-21T)525Card | ||||
| Internal Code | Ayu21-T525 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Tnpo1) |
||||