ID 21-T527
Registered: 2009.01.19 Last update: 2009.12.08
| Gene Name | nucleosome assembly protein 1-like 1 | Gene Symbol | Nap1l1 | |||
| Chromosome | 10 | Genomic Location | chr10:110,910,000-110,936,000 |  |
||
| Synonyms | NAP-1, AA407126, AI256722, D10Ertd68e | |||||
| Links |
UCSC Genome Browser(chr10:110,910,000-110,936,000) NCBI Gene(53605) IGTC(Nap1l1,1393) UNIGene(Mm.290407) |
MGI(1855693) KEGG GENES(mmu:53605) EST Profile(mm.290407) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-W513 |
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB477136 | GSS Location | chr10:110,910,318-110,918,372 | Size | 127 |
| Sequence | TGCTCCTCCCGCCGCCGCCGCTGCCGCCGCCCTGAGTCACTGCCTGCGCAGCTCCCGCCGCCCGG CTCCGCGTCCGAGCCTCCTGGAACGACATTTGGAGTTCTTACAAGATGGCCGACATTGACAA |
||||
| Links |
UCSC Browser(chr10:110,910,318-110,918,372) IGTC(Ayu21-T527) |
||||
Homology Search Results
| [D12618] Mus musculus NAP1 mRNA for nucleosome assembly protein-1, complete cds. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Nap1l1) |
||||