ID 21-T530
Registered: 2008.01.18 Last update: 2018.06.13
| Gene Name | spleen tyrosine kinase | Gene Symbol | Syk | |||
| Chromosome | 13 | Genomic Location | chr13:52,678,000-52,747,000 |  |
||
| Synonyms | Sykb | |||||
| Links |
UCSC Genome Browser(chr13:52,678,000-52,747,000) NCBI Gene(20963) IGTC(Syk,38001) UNIGene(Mm.375031) |
MGI(99515) KEGG GENES(mmu:20963) EST Profile(mm.375031) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB378559 | GSS Location | chr13:52,678,828-52,678,974 | Size | 147 |
| Sequence | CTCTCGGCAGCTGGAGGATCGGAGAACCGGGAGACTTCCACGGTGCGCGCCCCCGAAGCAAAACA ACGTCCCCAAGCATTTGAGATCCGGGACTGTCGTCGTGCGCGCCTGTGAGTTGCTGCAGAGTCCC AGCGCCTCTGAAATGCG |
||||
| Links |
UCSC Browser(chr13:52,678,828-52,678,974) IGTC(Ayu21-T530) |
||||
Homology Search Results
| [BB651788] BB651788 RIKEN full-length enriched mouse cDNA library, C57BL/6J ES cells Mus musculus cDNA clone C330013E14 5-, mRNA sequence gi|15402609|dbj|BB651788.1|[15402609] |
Mouse Information
| Card ID | 1116 | ||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Syk) |
||||