Gene Name | NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 2 | Gene Symbol | Ndufaf2 | |||
Chromosome | 13 | Genomic Location | chr13:108,840,000-108,950,000 | ![]() |
||
Synonyms | 1810058I14Rik, mimitin, Ndufa12l, C86051 | |||||
Links |
UCSC Genome Browser(chr13:108,840,000-108,950,000) NCBI Gene(75597) IGTC(Ndufaf2,9625) UNIGene(Mm.276040) |
MGI(1922847) KEGG GENES(mmu:75597) EST Profile(mm.276040) |
Other Clone Trapped This Gene |
---|
Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB378561 | GSS Location | chr13:108,948,637-108,948,799 | Size | 164 |
Sequence | TCGGGTTGAAGCCTCAGACCTTGAGTTCGGCGCAGGCATGAGCTGGTGGTCCGGTGTGTGGCGCT CTGTTTGGAGCGCCTTGTCCAGGGAGGTGAGGGAGCACGTGGGCACGGACCATCTGGGGAACAAA TACTACTACGTCGCCGAGTACAAGAACTGGAGAG |
||||
Links |
UCSC Browser(chr13:108,948,637-108,948,799) IGTC(Ayu21-T533) |
[BC116975] Mus musculus Ndufa12-like, mRNA (cDNA clone MGC:151352, IMAGE:40126294), complete cds. |
Card ID | |||||
Strain Name | |||||
Internal Code | |||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
Links |
IMSR (for Ndufaf2) |