Gene Name | GRAM domain containing 4 | Gene Symbol | Gramd4 | |||
Chromosome | 15 | Genomic Location | chr15:85,886,000-85,969,000 | ![]() |
||
Synonyms | 9930016O13 | |||||
Links |
UCSC Genome Browser(chr15:85,886,000-85,969,000) NCBI Gene(223752) IGTC(Gramd4,34276) UNIGene(Mm.24442) |
MGI(2676308) KEGG GENES(mmu:223752) EST Profile(mm.24442) |
Other Clone Trapped This Gene |
---|
Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB378564 | GSS Location | chr15:85,889,310-85,889,391 | Size | 82 |
Sequence | CAGGTGCAGCGCGGCCGGGTGGCCGGCCAGGGGGGCGCCGCGGCGGCGGGTGGATGAGAGTTGGC CCCGATCATCCCGCAGG |
||||
Links |
UCSC Browser(chr15:85,889,310-85,889,391) IGTC(Ayu21-T541) |
[CJ179538] CJ179538 RIKEN full-length enriched mouse cDNA library, Rathke-s pouches 14.5 days embryo Mus musculus cDNA clone M230011N09 5-, mRNA sequence, gi|76308274|dbj|CJ179538.1|[76308274] |
Card ID | 1167 | ||||
Strain Name | B6;CB-Gramd4Gt(pU-21T)541Imeg | ||||
Internal Code | Ayu21-T541 | ||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
Links |
IMSR (for Gramd4) |