ID 21-T544
Registered: 2008.01.18 Last update: 2018.06.13
| Gene Name | N-ethylmaleimide sensitive fusion protein attachment protein alpha | Gene Symbol | Napa | |||
| Chromosome | 7 | Genomic Location | chr7:16,683,000-16,704,000 |  |
||
| Synonyms | 1500039N14Rik, a-SNAP, hyh, RA81, SNAPA, SNARE, a-SNAP, AW209189, SNAP-alpha | |||||
| Links |
UCSC Genome Browser(chr7:16,683,000-16,704,000) NCBI Gene(108124) IGTC(Napa,34331) UNIGene(Mm.104540) |
MGI(104563) KEGG GENES(mmu:108124) EST Profile(mm.104540) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB378565 | GSS Location | chr7:16,683,952-16,684,123 | Size | 172 |
| Sequence | GAGTGCGCGGTGTCCGGGGCCTGTGAGTCGTCGCCAGGCTGTGTCGGGCCTGAGCCGAGCAGCTG CGCGACGTCATGGACAACTCCGGGAAGCAGGCTGAGGCTATGGCGCTGCTGGCTGAAGCGGAGCG CAAGGTGAAGAACTCGCAGTCCTTCTTCTCCGGCCTCTTTGG |
||||
| Links |
UCSC Browser(chr7:16,683,952-16,684,123) IGTC(Ayu21-T544) |
||||
Homology Search Results
| [AK171998] Mus musculus activated spleen cDNA, RIKEN full-length enriched library, clone:F830028F21 product:N-ethylmaleimide sensitive fusion protein attachment protein alpha, full insert sequence. |
Mouse Information
| Card ID | 1135 | ||||
| Strain Name | B6;CB-NapaGt(pU-21T)544Imeg | ||||
| Internal Code | Ayu21-T544 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.. | ||||
| Links |
IMSR (for Napa) |
||||