ID 21-T545
Registered: 2008.02.19 Last update: 2018.06.13
| Gene Name | RIKEN cDNA 3110056K07 gene | Gene Symbol | 3110056K07Rik | |||
| Chromosome | 12 | Genomic Location | chr12:72,091,952-72,117,230 |  |
||
| Synonyms | 4921536K06Rik | |||||
| Links |
UCSC Genome Browser(chr12:72,091,952-72,117,230) NCBI Gene(73204) IGTC(3110056K07Rik,) UNIGene(Mm.363770) |
MGI(1920454) KEGG GENES(mmu:) EST Profile(mm.363770) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB383668 | GSS Location | chr12:72,116,740-72,116,777 | Size | 58 |
| Sequence | GGCCCAAAAATTTGATTGGAGGAGCCGACTCCTAGATGTGTTGGAAGAGGAACCGAAA | ||||
| Links |
UCSC Browser(chr12:72,116,740-72,116,777) IGTC(Ayu21-T545) |
||||
Homology Search Results
Mouse Information
| Card ID | 2243 | ||||
| Strain Name | B6.Cg-UnknownGt(pU-21T)545Card | ||||
| Internal Code | Ayu21-T545 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for 3110056K07Rik) |
||||