ID 21-T58
Registered: 2006.07.02 Last update: 2018.06.13
| Gene Name | RAB27A, member RAS oncogene family | Gene Symbol | Rab27a | |||
| Chromosome | 9 | Genomic Location | chr9:72,892,000-72,947,500 |  |
||
| Synonyms | 2210402C08Rik, 2410003M20Rik, 4933437C11Rik, ash | |||||
| Links |
UCSC Genome Browser(chr9:72,892,000-72,947,500) NCBI Gene(11891) IGTC(Rab27a,19341) UNIGene(Mm.34867) |
MGI(1861441) KEGG GENES(mmu:11891) EST Profile(mm.34867) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB264308 | GSS Location | chr9:72,892,653-72,892,818 | Size | 167 |
| Sequence | AAAAATAGCGCCAAGCACCCAAAAAAGGCCAGTCGCACGGGGTCCCGAGCTCCATTTGGAAGGGA GTACCTAAGGGATAGAGCACAGCGAGGACGCGGCACGTTGGGAATCTAGCACTGCAGGGACGCAA CACCGCAGGGACAGCACCGGACAGAGCACCAAACCGG |
||||
| Links |
UCSC Browser(chr9:72,892,653-72,892,818) IGTC(Ayu21-T58) |
||||
Homology Search Results
| [BC008173] Mus musculus RAB27A, member RAS oncogene family, mRNA (cDNA clone MGC:11677 IMAGE:3710213), complete cds. |
Mouse Information
| Card ID | 784 | ||||
| Strain Name | B6;CB-Rab27aGt(pU-21T)58Card | ||||
| Internal Code | Ayu21-T58 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Rab27a) |
||||