ID 21-T61
Registered: 2006.07.20 Last update: 2018.06.13
| Gene Name | melanotransferrin | Gene Symbol | Meltf | |||
| Chromosome | 16 | Genomic Location | chr16:31,878,000-31,900,000 |  |
||
| Synonyms | CD228, melanotransferrin, Mfi2, MTf | |||||
| Links |
UCSC Genome Browser(chr16:31,878,000-31,900,000) NCBI Gene(30060) IGTC(Meltf,45982) UNIGene(Mm.30988) |
MGI(1353421) KEGG GENES(mmu:30060) EST Profile(mm.30988) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB266493 | GSS Location | chr16:31,883,953-31,884,029 | Size | 77 |
| Sequence | TGTGGGCTGGAACGTGCCTGTCGGTTACCTCGTAGAGAGCGGCCATCTGTCAGTGATGGGCTGTG ATGTGCTCAAAG |
||||
| Links |
UCSC Browser(chr16:31,883,953-31,884,029) IGTC(Ayu21-T61) |
||||
Homology Search Results
| [BC040347] Mus musculus antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5, mRNA (cDNA clone MGC:18315 IMAGE:3672916), complete cds. |
Mouse Information
| Card ID | 832 | ||||
| Strain Name | B6;CB-Mfi2Gt(pU-21T)61Imeg | ||||
| Internal Code | Ayu21-T61 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Meltf) |
||||