ID 21-T66
Registered: 2006.12.06 Last update: 2018.06.13
| Gene Name | vacuolar protein sorting 37B | Gene Symbol | Vps37b | |||
| Chromosome | 5 | Genomic Location | chr5:124,454,000-124,483,000 |  |
||
| Synonyms | 37B2300007F24Rik, AI415429, BC026744, 2300007F24Rik | |||||
| Links |
UCSC Genome Browser(chr5:124,454,000-124,483,000) NCBI Gene(330192) IGTC(Vps37b,12361) UNIGene(Mm.472729) |
MGI(1916724) KEGG GENES(mmu:330192) EST Profile(mm.472729) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB286656 | GSS Location | chr5:124,482,111-124,482,160 | Size | 48 |
| Sequence | TGCTGGAGGACGATGCACAGCTCGGCGATGGTGCGGGGTATGGAAGAG | ||||
| Links |
UCSC Browser(chr5:124,482,111-124,482,160) IGTC(Ayu21-T66) |
||||
Homology Search Results
| [AK172337] Mus musculus activated spleen cDNA, RIKEN full-length enriched library, clone:F830203C07 product:hypothetical Modifier of rudimentary (Mod/Proline-rich region profile containing protein, full insert sequence. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Vps37b) |
||||