ID 21-T73

Registered: 2006.07.21   Last update: 2018.06.14
Gene Name RNA binding protein gene with multiple splicing Gene Symbol Rbpms
Chromosome 8 Genomic Location chr8:34,890,000-35,045,000
Synonyms 2010300K22Rik, 2700019M19Rik, hermes, RBP-MS; AU017537
Links UCSC Genome Browser(chr8:34,890,000-35,045,000)
NCBI Gene(19663)
IGTC(Rbpms,201)
UNIGene(Mm.323997)
MGI(1334446)
KEGG GENES(mmu:19663)
EST Profile(mm.323997)
Other Clone Trapped This Gene
21-T347, K16E08
Trap Vector pU-21T Cell Line KTPU8 Method 5'-RACE
Accession AB266495 GSS Location chr8:35,039,948-35,040,061 Size 114
Sequence CCTCCAACCCCGCGCCCCAGTCCCGCGCGGCGACGAAGGACCGGGAAGATGAACGGCGGCGGCAA
AGCCGAGAAGGAGAACACCCCGAGCGAGGCCAACCTTCAGGGGGAGGAG
Links UCSC Browser(chr8:35,039,948-35,040,061)
IGTC(Ayu21-T73)

Homology Search Results

[BC030397] Mus musculus RNA binding protein gene with multiple splicing, mRNA (cDNA clone MGC:40656 IMAGE:4225078), complete cds.

Mouse Information

Card ID 828
Strain Name B6;CB-RbpmsGt(pU-21T)73Card
Internal Code Ayu21-T73
Description This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for Rbpms)