ID 21-T73
Registered: 2006.07.21 Last update: 2018.06.14
| Gene Name | RNA binding protein gene with multiple splicing | Gene Symbol | Rbpms | |||
| Chromosome | 8 | Genomic Location | chr8:34,890,000-35,045,000 |  |
||
| Synonyms | 2010300K22Rik, 2700019M19Rik, hermes, RBP-MS; AU017537 | |||||
| Links |
UCSC Genome Browser(chr8:34,890,000-35,045,000) NCBI Gene(19663) IGTC(Rbpms,201) UNIGene(Mm.323997) |
MGI(1334446) KEGG GENES(mmu:19663) EST Profile(mm.323997) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-T347, K16E08 |
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB266495 | GSS Location | chr8:35,039,948-35,040,061 | Size | 114 |
| Sequence | CCTCCAACCCCGCGCCCCAGTCCCGCGCGGCGACGAAGGACCGGGAAGATGAACGGCGGCGGCAA AGCCGAGAAGGAGAACACCCCGAGCGAGGCCAACCTTCAGGGGGAGGAG |
||||
| Links |
UCSC Browser(chr8:35,039,948-35,040,061) IGTC(Ayu21-T73) |
||||
Homology Search Results
| [BC030397] Mus musculus RNA binding protein gene with multiple splicing, mRNA (cDNA clone MGC:40656 IMAGE:4225078), complete cds. |
Mouse Information
| Card ID | 828 | ||||
| Strain Name | B6;CB-RbpmsGt(pU-21T)73Card | ||||
| Internal Code | Ayu21-T73 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Rbpms) |
||||