ID 21-T80
Registered: 2006.10.02 Last update: 2018.06.14
| Gene Name | F-box protein 34 | Gene Symbol | Fbxo34 | |||
| Chromosome | 14 | Genomic Location | chr14:48,090,000-48,153,000 |  |
||
| Synonyms | 2900057B08Rik, 5830426G16Rik | |||||
| Links |
UCSC Genome Browser(chr14:48,090,000-48,153,000) NCBI Gene(78938) IGTC(Fbxo34,15260) UNIGene(Mm.11935) |
MGI(1926188) KEGG GENES(mmu:78938) EST Profile(mm.11935) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB275895 | GSS Location | chr14:48,092,309-48,092,392 | Size | 84 |
| Sequence | AGTGTCGGGGAGCGAGTCAGGCCTGCCGCCGCCGCATCGGGCTGCCGCAGCCCCGGGCCAGGCCC TGGCCCGGCAGAAGCACAG |
||||
| Links |
UCSC Browser(chr14:48,092,309-48,092,392) IGTC(Ayu21-T80) |
||||
Homology Search Results
| [AK020018] Mus musculus adult male thymus cDNA, RIKEN full-length enriched library, clone:5830426G16 product:hypothetical Immunoglobulin and major histocompatibility complex domain/F-box domain containing protein, full insert sequence. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Fbxo34) |
||||