| Gene Name | translocase of inner mitochondrial membrane 8B | Gene Symbol | Timm8b | |||
| Chromosome | 9 | Genomic Location | chr9:50,411,000-50,423,000 | |||
| Synonyms | Tim8b, Ddp2 | |||||
| Links |
UCSC Genome Browser(chr9:50,411,000-50,423,000) NCBI Gene(30057) IGTC(Timm8b,5375) UNIGene(Mm.379061) |
MGI(1353424) KEGG GENES(mmu:30057) EST Profile(mm.379061) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB277855 | GSS Location | chr9:50,412,052-50,413,291 | Size | 347 |
| Sequence | ACTCCGACAATGGCCGAGCTTGGTGAAGCGGACGAAGCGGAGTTACAACGCCTGGTGGCCGCCGA ACAGCAGAAGGCGCAATTCACTGCGCAGGTGCATCACTTCATGGAACTATGTTGGGATAAGTGTG TGGAGAAGCCAGGAAGTCGGCTAGACTCCCGCACTGAAAACTGCCTCTCTAGCTGTGTGGATCGC TTCATTGACACTACTCTTGCCATCACCGGTCGGTTTGCCCAGATCGTACAGAAAGGAGGGCAGTA GGCCATACCTTAGAATGACAGAAGACCAAAAGACTTGTTACCAAGCAGATTGAATGGCCAGTGGT GAAAGACCTGCCAACCAGTCAG |
||||
| Links |
UCSC Browser(chr9:50,412,052-50,413,291) IGTC(Ayu21-T84) |
||||
| [NM_013897] Mus musculus translocase of inner mitochondrial membrane 8 homolog b (yeast) (Timm8b), nuclear gene encoding mitochondrial protein, mRNA. |
| [AF196314] Mus musculus small zinc finger-like protein DDP2 (Ddp2) mRNA, complete cds. |
| [AK004190] Mus musculus 18-day embryo whole body cDNA, RIKEN full-length enriched library, clone:1110046L21 product:translocase of inner mitochondrial membrane 8 homolog b (yeast), full insert sequence. |
| Card ID | 1209 | ||||
| Strain Name | B6;CB-Ddp2Gt(pU-21T)84Card | ||||
| Internal Code | Ayu21-T84 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Timm8b) |
||||