ID 21-T93
Registered: 2006.10.12 Last update: 2018.06.14
| Gene Name | nuclear speckle regulatory protein 1 | Gene Symbol | Nsrp1 | |||
| Chromosome | 11 | Genomic Location | chr11:76,857,000-76,893,000 |  |
||
| Synonyms | Ccdc55, NSpr70, NSrp70, AI851076, AL022898, 8030451K07 | |||||
| Links |
UCSC Genome Browser(chr11:76,857,000-76,893,000) NCBI Gene(237859) IGTC(Nsrp1,5033) UNIGene(Mm.156195) |
MGI(2144305) KEGG GENES(mmu:237859) EST Profile(mm.156195) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB277857 | GSS Location | chr11:76,891,881-76,891,966 | Size | 87 |
| Sequence | ATATACACGTCGGCGTCAGCGTCTCGTCACGTCCGCGTCGACCAGGTCCAGCGGAGACGGGAACA AGATGGCGATCCCGNTCAGGCA |
||||
| Links |
UCSC Browser(chr11:76,891,881-76,891,966) IGTC(Ayu21-T93) |
||||
Homology Search Results
| [BC089560] Mus musculus coiled-coil domain containing 55, mRNA (cDNA clone MGC:107323 IMAGE:30300075), complete cds. |
| [AK161058] Mus musculus 0 day neonate skin cDNA, RIKEN full-length enriched library, clone:4632413D16 product:hypothetical protein, full insert sequence. |
Mouse Information
| Card ID | 840 | ||||
| Strain Name | B6;CB-Ccdc55Gt(pU-21T)93Imeg | ||||
| Internal Code | Ayu21-T93 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
[Paper] "NSrp70 is a novel nuclear speckle-related protein that modulates alternative pre-mRNA splicing in vivo." Young-Dae Kim, Jung-Yoon Lee, Kyu-Man Oh, Masatake Araki, Kimi Araki, Ken-ichi Yamamura, and Chang-Duk Jun, Nucleic Acids Research, 39, 4300-4314 (2011). PubMed ID:21296756. |
||||
| Links |
IMSR (for Nsrp1) |
||||