Gene Name | zinc finger protein 985 | Gene Symbol | Zfp985 | |||
Chromosome | 4 | Genomic Location | chr4:146,591,589-146,714,021 | |||
Synonyms | Gm13154 | |||||
Links |
UCSC Genome Browser(chr4:146,591,589-146,714,021) NCBI Gene(433804) IGTC(Zfp985,12769) UNIGene(Mm.332047) |
MGI(3651986) KEGG GENES(mmu:433804) EST Profile(mm.332047) |
Other Clone Trapped This Gene |
---|
21-W240 |
Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB279761 | GSS Location | chr4:146,604,382-146,606,552 | Size | 256 |
Sequence | ATTCCAGCATTCTCAATGTATCTCGGCTGCCTCGTGGTCAGGAAGTCTTGGAGGGAGACTAGTGC CTAGTGTTTGCGGAACCTGAAAACTTCCTTAAGCTGCAGTTGCTGTGCTGGCCTCCTAGGATATT CAGCAGCTGGTCCTGTCACCTGCCAGATCAGAGGTCTCCATATGCTCATTCAAATCTCCATAACT GTAAATCAACACTAAGAGCACTGGATAGTTAAGGTCAAGGAGACTCTCACAAAGGATCCAG |
||||
Links |
UCSC Browser(chr4:146,604,382-146,606,552) IGTC(Ayu21-T97) |
[AK049536] Mus musculus 7 days embryo whole body cDNA, RIKEN full-length enriched library, clone:C430020H24 product:hypothetical KRAB box containing protein, full insert sequence. |
Card ID | |||||
Strain Name | |||||
Internal Code | |||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
Links |
IMSR (for Zfp985) |