Gene Name | SR-related CTD-associated factor 4 | Gene Symbol | Scaf4 | |||
Chromosome | 16 | Genomic Location | chr16:90,228,000-90,286,000 | ![]() |
||
Synonyms | Sra4, Sfrs15, Srsf15, AA517739 | |||||
Links |
UCSC Genome Browser(chr16:90,228,000-90,286,000) NCBI Gene(224432) IGTC(Scaf4,6561) UNIGene(Mm.439811) |
MGI(2146350) KEGG GENES(mmu:224432) EST Profile(mm.439811) |
Other Clone Trapped This Gene |
---|
Trap Vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB299417 | GSS Location | chr16:90,284,248-90,284,409 | Size | 183 |
Sequence | CCGGACGGCCTCGACTGGTGGTCGCCTCCCGTCCTCCTCCCCCTCCACGCCCAAGGGCCCTGCCG GCACCCGGCCCTACTCAAGCCGCCGCTCCAGGTCTAGGTGACCGGCGGGCCCGGAGCAGCCGCAG CCGCCGCCGCAACGCGCGCGAACATGGACGCCGTCAACGCCTTCAACCAGGAG |
||||
Links |
UCSC Browser(chr16:90,284,248-90,284,409) IGTC(Ayu21-T98) |
[BC053096] Mus musculus splicing factor, arginine/serine-rich 15, mRNA (cDNA clone MGC:62487 IMAGE:6401143), complete cds. |
Card ID | |||||
Strain Name | |||||
Internal Code | |||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
Links |
IMSR (for Scaf4) |