ID 21-108
Registered: 2004.06.01 Last update: 2006.12.29
| Gene Name | 45S rRNA gene intergenic spacer | Gene Symbol | 45SrRNAint | |||
| Chromosome | Unlocalized | Genomic Location | Unlocalized |  |
||
| Synonyms | ||||||
| Links |
UCSC Genome Browser(Unlocalized) NCBI Gene() IGTC(45SrRNAint,) UNIGene(Mm.) |
MGI() KEGG GENES(mmu:) EST Profile(mm.) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-B148, 21-MT55, 21-MT9, 21-T335, 21-T23, 21-39, 21-B113, 21-MT81, 21-T105, 21-B130, 21-MT6, 21-T107, 21-MT33, 21-MT71, 21-MT35, 21-MT14, 21-MT10, 21-MT37, 21-MT75, 21-MT86, 21-MT7, 21-MT49, 21-MT68, 21-T212, 21-T223, 21-T235, 21-T251, 21-MT2, 21-MT34, 21-MT69, 21-MT77, 21-MT43, 21-MT26, 21-MT100, 21-MT104, 21-MT106, 21-MT112, 21-MT125, 21-MT128, 21-B143 |
| Trap Vector | pU-21 | Cell Line | KTPU10 | Method | 5'-RACE |
| Accession | AB187258 | GSS Location | Size | 153 | |
| Sequence | CTCTTACCCACTGAGCCATCTCACCAGCCCGTATGCATGCATTATTATGCATGAAACTACACTGC AGCTGTCTTCAGACACACACCAGAAGAATACATGGGATCCCACGGCAGATGGTTGTTGGAAATTG AACTCAGGACCTCTGGAAGAGAG |
||||
| Links |
UCSC Browser() IGTC(Ayu21-108) |
||||
Homology Search Results
| [AF441733] Mus musculus clone RP23-225M6 45S pre-ribosomal RNA gene, partial sequence; and intergenic spacer, partial sequence. |
Mouse Information
| Card ID | 454 | ||||
| Strain Name | B6;CB-UnknownGt(Ayu21)108Imeg | ||||
| Internal Code | Ayu21-108 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21, and feeder free ES cell line; KTPU10 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for 45SrRNAint) |
||||